Phosphorus (Pi) is one of the important nutrients for plant growth and development. It has a major role in metabolic processes including energy transfer, signal transduction, biosynthesis of macromolecules, photosynthesis and respiration (Schachtman et al., 1998). However, Pi is easily combined with other mineral existing in soils such as Al, Fe and Ca then transformed insoluble phosphorus which plant cannot use. Pi deficiency limits plant growth and crop productivity throughout the world (Sanchez and Salinas, 1981). phosphorus fertilizer has been used to get more yields against to Pi deficiency. Around 90% of phosphorus in phosphorus fertilizer was derived from phosphorus rocks (Brunner, 2010). The more food demand for an increasing global population, the more phosphorus rock needs. Several studies suggest that phosphorus rock reserves could be depleted within 5 ~ 100 years (Steen, 1998; De Haes et al., 2009; Smit et al., 2009; Vaccari, 2009; Cordell, 2010). Therefore, many researches have been conducted to develop plant which is more resistant against phosphorus deficient stress (Kaeppler et al., 2000; Wissuwa et al., 2005; Beebe et al., 2006; Heuer et al., 2009).
Plants have developed several mechanisms to efficiently enhance uptake and utilize of Pi including morphological and biochemical changes in Pi-deficient condition. Since Pi concentrations within plant cells are typically 1000-times more than those of soils, the acquisition process of Pi in plant roots is accomplished through its active absorption via the Pi transporters (PTs) into epidermal and cortical cells of the root. A number of plant PT genes have been identified in plants based on the amino acid homology with yeast (Sacchaomyces cerevisiae) PT (PHO84) and functionally characterized using yeast mutants lacking endogenous high-affinity PTs or plant suspension cells (Raghothama, 1999; Rausch and Bucher, 2002; Rae et al., 2003). In Arabidopsis (Arabidopsis thaliana), only two of the nine Pht1 Pi transporters have been functionally characterized (Misson et al., 2004; Shin et al., 2004; Catarecha et al., 2007). Thirteen putative high-affinity Pi transporter genes belonging to the Pht1 family have been identified in the rice (Oryza sativa) genome (Goff et al., 2002).
In the previous study, we developed transgenic rice using four kinds of phosphorus transporter to investigate the growth and phosphorus uptake character by over-expressing OsPTs. Among them, the yield of OsPT6 over-expressing transgenic rice was 3% higher than that of wild type plant under Pi deficient condition (Song et al., 2011). Thus OsPT6 was reported being broadly involved in Pi uptake and translocation through the plants (Ai et al., 2009). OsPT6 was expressed in both epidermal and cortical cells of the younger primary and lateral root and was able to complement a yeast Pi uptake mutant in the high-affinity concentration range. However the change of agronomic characters by over-expression of OsPT6 has not been investigated yet under Pi deficient condition.
In this study, we investigated the agronomic and Pi-deficient stress resistance characters using transgenic rice which have over-expression of OsPT6 (OsPT6-OX) to confirm usability of OsPT6 in breeding for Pi deficient rice.
MATERIALS AND METHOD
Generation of Transgenic Plants
For cloning of OsPT6 gene, a specific primer set which included the XbaI site (forward: TGTCTAGACATGGGCGGCGGCGG, reverse: GCTCTAGAATTACTACAGTACAGTT) was used to amplified OsPT6 gene. After digestion of the PCR product with XbaI, the OsPT6 gene was fused into the pBTEX binary vector. The expression construct was introduced into A. tumefaciens (EHA105) by tri-parental mating. Transgenic rice (OsPT6-OX), overexpressing OsPT6 gene, was generated by Agrobacteriummediated transformation in the Japonica rice cultivar, Dongjin (Seo et al. 2008). Transgenic lines were selected based on the OsPT6 gene expression level.
Hydroponic Experiments
Seeds of OsPT6-OX1, OsPT6-OX2 and wild type were used as materials. Twenty-day old seedlings were transferred and cultured in nutrient solution for two weeks in the greenhouse under a natural photoperiod. The nutrient composition and concentration for control (P) nutrient solution were as follows: N (1.43 mM), P (0.32 mM), K (0.51 mM), Ca (0.75 mM), Mg (1.64 mM), Fe (0.51 μM), B (18.92 μM), Mn (9.50 μM), Mo (0.10 μM), Zn (0.15 μM) (Yoshida et al. 1976). For Pi deficient condition (-P), 0.032 μM of phosphorus was added. The pH of the nutrient solution was adjusted to pH 5.5 using NaOH and the solution was changed every three days. The shoot and root length of each materials were measured before and after cultivating in hydroponic nutrient then the change of those length were measured as growth rate.
RNA Extract and Quantitative real-time RT-PCR (qRT-PCR)
Total RNA from root and shoot tissues of materials which cultivated for 14 days in hydroponic nutrient solution were extracted using TRIzol reagent (Invitrogen, USA). 100ng of each RNA was used for qRT-PCR. qRTPCR was conducted using the SYBR 433 green master mix (SYBR Premix Ex Tag TM II, TaKaRa). Gene specific primer sets of OsPTs and OsActin(accession number AB047313) for qRT-PCR were shown in Table 1.
Pot and Field Experiments
Pot experiment was performed in a greenhouse with four replications using the P deficient soil collected from mountain. The acid soil (pH 5.0, soil : water = 1:1) contained 4mg Pi kg– 1 extracted by the Bray I method (Bray and Kurtz, 1945). Four different treatment of Pi were treated as 0, 20, 80 and 100% to create 0P, 0.2P, 0.5P and P treatment (160 mg fertilizer Pi kg– 1soil) respectively.
A field experiment was conducted in the GMO field of the National Institute of Crop Science (Miryang, Republic of Korea) from June to October over 2011 and 2012. Three different fertilization conditions were created in a paddy field. Fertilizer application rates for control condition were 9kg of Nitrogen (N), 4.5kg of phosphorus (P205) and 5.7 kg of potassium (K20) per 10 are. For Pi-deficient condition (-P), 9kg of nitrogen and 4.5kg of potassium fertilizer were treated without phosphorus fertilizer. A five times greater amount of phosphorus fertilizer (22.5kg/10a) than control condition was added with 9kg of nitrogen and 4.5kg of potassium fertilizer for excess phosphorus condition (+P). Thethirty-day old OsPT6-OX1, OsPT6-OX2 and wild-type plants were transplanted into a paddy field. The tiller and panicle number were determined by 10 replications at ripening stage. Three plants were harvested at each plot then ripening rate was measured. The yield of those was determined at forty-day after heading date.
Analysis of Plant Phosphorus and Chlorophyll Content
Plants were cutted at ground level, washed in tap water and dried at 60°C for three days. Dried plants were divided into leaves, stems and grains, and dry weight was measured. The phosphorus content of each sample was measured using the vanadate method (NIAST, 2000).
To determine leaf chlorophyll content, fresh leaves were grounded and extracted with 100% acetone for 3 days. The chlorophyll content of extracts was analyzed using spectrophotometer (Porra, 2002).
Statistical Analysis
SAS version 9.2 (SPSS Inc) was used for data analysis. Duncan’s multiple range test (DMRT) was carried out to identify significant differences (P < 0.05) between individual treatments.
RESULT
Growth Characters of the OsPT6-OXs under Pi Deficient Hydroponic Solution
In hydroponic nutrient experiment, the shoot growth rate of wild-type plant in -P condition was decreased about 25 % compared to those in control condition. However, shoot growth rate of both transgenic plantss, OsPT6-OX1 and OsPT6-OX2, increased about 13 ~ 18 % in -P condition more than in control condition. The root growth rate of both wild-type plant and transgenic plantss did not significantly change in -P condition. Fresh weight of wild plant in -P condition decreased about 10%, but those of both transgenic plantss were increased 17 ~ 25% under -P condition than those under control condition due to the shoot growth in -P condition (Fig. 1(a), (b), (c)). The growth of three leaves depend on leaf age were checked to investigate the effect of Pi condition on leaf growth. In wild type plant, the growth of the third leaf which was the youngest leaf decreased about 60% under -P condition showed the highest reduction compare to that under control condition. Also, the growths of the second and the first leaf decreased 45% and 55% respectively under -P condition compared to that in control condition. In transgenic plantss, the second leaf weight of transgenic plantss decreased 20 ~ 30% under -P condition compared to control condition. However, fresh weight of the first leaf in transgenic plantss did not show significant difference, even that of third leaf was increased by 10 ~ 20 % (Fig. 1(d)).
The chlorophyll content of leaves in wild type plant increased 80 ~ 200% under -P condition compared to that under control condition. Among leaves in wild type plant, the third leaf chlorophyll content was increased most significantly. In contrast, chlorophyll contents of the first and second leaf in transgenic plants showed lower increment compare to wild type, even the chlorophyll content of the third leaf in –P condition decreased about 10% compared to that under control condition (Fig. 1(e)).
To determine effect of OsPT6 over-expression on other PTs members expression in rice, total RNA was extracted and qRT-PCR was conducted using transgenic plants cultivated in under -P nutrient solution. Under the Pi-deficient condition, several PT genes were up regulated upon overexpression of OsPT6. Among them, OsPT2 and OsPT5 were significantly up regulated in both shoot and root under Pi deficient condition (Fig. 2).
Agronomic Characters of the OsPT6-OXs under Pi Deficient Soil Condition
To investigate the growth change of the OsPT6-OXs according to Pi condition, OsPT6-OXs and wild-type plant were cultivated in pot and field with different Pi treatment. In pot experiment, four different Pi condition were created with 0P (0%), 0.2P (20%) and 0.5P (50 %) of Pi based on control condition (P, 100%). The height of wild type and transgenic plants increased slightly under 0.5P treatment. In 0P and 0.2P treatment, the height of wild type plant was gradually decreased from 5 ~ 10% compared to that in P condition. The height of transgenic plants decreased 3 ~ 5% according to Pi treatment reduction. The tiller number of wild type plant decreased significantly under 0.5P, 0.2P and 0P treatment with 20 %, 55 % and 70 % reduction respectively. In transgenic plants, the tiller number decreased, 10 ~ 15 %, 30 ~ 35 % and 60 % in 0.5P, 0.2P and 0P treatment respectively (Fig. 3).
In field treatment, the agronomic characters were investigated in deficient (−P), surplus (+P) and control condition. The tiller number of wild type plant decreased in -P condition and increased in +P condition significantly. Panicle number was increased about 6% in –P condition and ripening rate significantly was decreased about 10% in +P condition in wild type plant. However those did not show significant difference in transgenic plantss (Fig. 4).
Phosphorus Contents of Transgenic Plants under Different Pi Condition.
The phosphorus contents of transgenic plants did not show any difference from wild type plant in +P condition. Those of wild type plant gradually were decreased from 0.3% to 0.18% according to decreasing of Pi supply. However, phosphorus content of OsPT6-OX1 and OsPT6-OX2 were not changed in 0.5 P treatment. In 0.2 P and 0P treatment, even phosphorus content of transgenic plants decreased about 0.03% and 0.1%, that of transgenic 1.2 ~ 1.3 fold and 1.4 ~ 1.5 fold higher than that of wildtype plant respectively (Fig. 5(a)). The phosphorus content was high in shoot under +P condition in both wild type plant and transgenic plants. In wild type plant, shoot Pi content decreased significantly in 0.5P, 0.2P and 0P treatment. In contrast, shoot Pi content of both transgenic plants did not decrease under -P condition. (Fig. 5(b), (c), (d)).
DISCUSSION
When P is limited, plant cannot growth well thus leaf expansion and leaf surface area decrease significantly and causeing symptoms of dark to blue-green coloration (R. Uchida. 2000). Ladouceur (2006) also reported chlorophyll content in leaves of barley was enhanced under low Pi condition. Therefore, we examined the shoot growth and chlorophyll content of each leaf on both wild-type and transgenic plants to investigate the effect of Pi deficiency after cultivating in nutrient solution. The shoot growth rate of OsPT6-OXs showed about 1.2 times more increased under Pi deficient condition compare with control condition while that of wild-type plant decreased. The fresh weight of OsPT6-OX was also about 1.15 times more increased under Pi deficient condition compare to control condition. Analyzing the growth rate of each leaf, all leaves of OsPT6-OX showed higher growth rate than wildtype plant. Among leaves, the youngest leaf of wild-type plant showed the highest growth reduction, while the youngest leaf of OsPT6-OXs showed 10 ~ 20% increase in Pi deficient condition than control condition. The chlorophyll content of the youngest leaf in wild-type plant more increased about 3.2 times significantly, while that in OsPT6-OX decreased. These results suggest that overexpression of OsPT6 in rice could increase tolerance on leaf growth against to Pi deficient, especially in the youngest leaf of plant.
In monitoring phosphorus deficient tolerance in rice, the tillering ability was reported for the best marker (Hung, 1985). Also, Wissuwa et al. (1998) reported that phosphorus uptake and phosphorus-use efficiency could be monitored indirectly by dry weight and tiller number. We investigated tiller number of OsPT6-OXs under Pi deficient condition at pot experiment by using Pi deficient soil. In our study, the reduction rate of tiller number in OsPT6- OX was about 2 times in 0.5 P and 1.4 times in 0.2 P which were less than that of wild type plant. This result might indicate OsPT6-OXs could get more tiller in Pi deficient condition than wild-type plant. Thus over-expressing of OsPT6 could increase tillering ability in rice under Pi deficient condition.
In plant, translational products of several PTs genes share the function to uptake Pi from soils. Under the Pi deficient condition, several PT genes were up regulated upon over-expression of OsPT6 (Fig. 2.) Jia et al. (2011) reported OsPT2 and OsPT5 were significantly up-regulated in OsPT8-OX plant and suggested that OsPT2 and OsPT5 might have function to assist OsPT8 on Pi translocation. In OsPT6-OX, expression of OsPT2 and OsPT5 were also significantly increased both in shoot and root. These results suggest OsPT2 and OsPT5 might assist to Pi translocation in OsPT6-OX.
Ai et al.,(2009) reported that shoot Pi content of Ospt6 RNAi plants was decreased more than that of wild type plant in Pi deficient condition. The similar results by analyzing Pi content of transgenic plants were observed in this study. Plant Pi content of OsPT6-OX was not different from wild type plant in Pi sufficient condition. That of wild type plant gradually decreased according to Pi reduction. However that of OsPT6-OX did not change in 50% Pi reduction and 80% Pi reduction. Even though, Pi contents of shoot and root in both OsPT6-OXs and wild type plant were high under Pi sufficient condition, shoot Pi content was significantly decreased in wild type plant. However that did not show significant decrement in OsPT6-OXs. Further analysis is needed to investigate the Pi content of shoot by OsPT6 over-expression.
To analyzing yield and agronomic characters of OsPT6- OX according to Pi condition, we cultivated OsPT6-OX and wild-type plant in paddy field treated by Pi deficient and Pi surplus over two years. The agronomic characters related with yield such as tiller, panicle number and ripening rate were changed in wild type plant while those of traits were not show significant difference in OsPT6-OX. With changes of agronomic character, the yield of wild type plant was observed 10% decrease under Pi deficient condition. However that of OsPT6-OX was not changed.
All these results suggested that OsPT6-OX might have more resistance against to Pi deficient condition than wild type plant thus it might get more stable yield without any Pi treatment in cultivated field.
SUMMARY
OsPT6-OX transgenic plants, which have OsPT6 overexpression, showed more Pi deficient resistance compared to wild type plant with increasing of shoot growth and decreasing of leaf chlorophyll content when cultivated in Pi deficient nutrient solution. In pot experiment, the tiller number OsPT6-OXs were less decreased than wild type plant in Pi deficient condition. In field experiment, tiller and panicle number, ripening rate were changed in wild type plant according to Pi treatment, while those did not show significant difference in OsPT6-OXs. While the yield of wild type plant was decreased 10% in Pi deficient condition, those of OsPT6-OX was not changed.
